pEGFR-PATagRFP
(Plasmid #31950)

• Depositing Lab: Vladislav Verkhusha
• Publication: Subach et al J Am Chem Soc. 2010 May 12;132(18):6481-91.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PATagRFP
• Alt name: photoactivatable dark-to-red TagRFP red fluorescent protein
• Insert Size (bp): 702
• Mutation: R69S/F84W/Q139K/A147P/N148S/M151K/Y153K/S165V/H203R/R207I/V218W/C229S compared to TagRFP (but numbering relative to EGFP)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGF receptor (EGFR) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (unknown if destroyed)
• 3′ cloning site: BsrGI (unknown if destroyed)
• 5′ sequencing primer: cggtaggcgtgtacggtgggag
• 3′ sequencing primer: gttcagggggaggtgtgggagg

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry