pPATagRFP-a-tubulin
(Plasmid
#31934)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-a-Tubulin
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5334
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePATagRFP
-
Alt namephotoactivatable dark-to-red TagRFP red fluorescent protein
-
Insert Size (bp)705
-
MutationR69S/F84W/Q139K/A147P/N148S/M151K/Y153K/S165V/H203R/R207I/V218W/C229S compared to TagRFP (but numbering relative to EGFP).
- Promoter CMV
-
Tag
/ Fusion Protein
- a-tubulin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BglII (unknown if destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPATagRFP-a-tubulin was a gift from Vladislav Verkhusha (Addgene plasmid # 31934) -
For your References section:
Bright monomeric photoactivatable red fluorescent protein for two-color super-resolution sptPALM of live cells. Subach FV, Patterson GH, Renz M, Lippincott-Schwartz J, Verkhusha VV. J Am Chem Soc. 2010 May 12;132(18):6481-91. 10.1021/ja100906g PubMed 20394363