pPAmCherry-a-tubulin
(Plasmid #31930)

• Depositing Lab: Vladislav Verkhusha
• Publication: Subach et al Nat Methods. 2009 Feb;6(2):153-9. Epub 2009 Jan 25.

Backbone

• Vector backbone: pEGFP-a-Tubulin
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 5328
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PAmCherry1
• Alt name: photoactivatable dark-to-red mCherry red fluorescent protein
• Insert Size (bp): 708
• Promoter: CMV
• Tag / Fusion Protein:
  • a-tubulin (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (unknown if destroyed)
• 3′ cloning site: BsrGI (unknown if destroyed)
• 5′ sequencing primer: cggtaggcgtgtacggtgggag

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry