pH2B-PSmOrange
(Plasmid #31920)

• Depositing Lab: Vladislav Verkhusha
• Publication: Subach et al Nat Methods. 2011 Jul 31;8(9):771-7. doi: 10.1038/nmeth.1664.

Backbone

• Vector backbone: pN1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PSmOrange
• Insert Size (bp): 711
• Mutation: S21T, Q63L, F100Y, L125M, K166R, P192S in PSmOrange (mutations are relative to mOrange but numbering is relative to EGFP)
• Tag / Fusion Protein:
  • H2B (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: We used 3' sequencing primer
• 3′ sequencing primer: gttcagggggaggtgtgggagg

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a V119I amino acid change in Addgene's quality control sequence for H2B. It does not alter the function of this plasmid.