-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepC1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePSmOrange
-
Insert Size (bp)708
-
MutationS21T, Q63L, F100Y, L125M, K166R, P192S in PSmOrange (mutations are relative to mOrange but numbering is relative to EGFP)
-
Tag
/ Fusion Protein
- Tubulin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CGGTAGGCGTGTACGGTGGGAG
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPSmOrange-Tubulin was a gift from Vladislav Verkhusha (Addgene plasmid # 31919 ; http://n2t.net/addgene:31919 ; RRID:Addgene_31919) -
For your References section:
A photoswitchable orange-to-far-red fluorescent protein, PSmOrange. Subach OM, Patterson GH, Ting LM, Wang Y, Condeelis JS, Verkhusha VV. Nat Methods. 2011 Jul 31;8(9):771-7. doi: 10.1038/nmeth.1664. 10.1038/nmeth.1664 PubMed 21804536