-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4012
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMedium-FT
-
Alt nameblue-to-red fluorescent timer
-
Insert Size (bp)711
-
MutationM18L/N23D/T43S/K69R/L84W/M152I/Q194L/L205M/Y221C/R227H compared to mCherry (but numbering relative to EGFP)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMedium-FT-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31911 ; http://n2t.net/addgene:31911 ; RRID:Addgene_31911) -
For your References section:
Monomeric fluorescent timers that change color from blue to red report on cellular trafficking. Subach FV, Subach OM, Gundorov IS, Morozova KS, Piatkevich KD, Cuervo AM, Verkhusha VV. Nat Chem Biol. 2009 Feb;5(2):118-26. Epub 2009 Jan 11. 10.1038/nchembio.138 PubMed 19136976