-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31875 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTight-N106
-
Backbone manufacturerhome made/Crabtree lab
- Backbone size w/o insert (bp) 7602
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNeuroD2
-
Alt nameND2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1184
-
Entrez GeneNEUROD2 (a.k.a. NDRF, bHLHa1)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atgtcgaggtaggcgtgtac
- 3′ sequencing primer gtggatgtggaatgtgtgcga (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTight-hND2-N106 was a gift from Jerry Crabtree (Addgene plasmid # 31875 ; http://n2t.net/addgene:31875 ; RRID:Addgene_31875) -
For your References section:
MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754