-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTLemiR
-
Backbone manufacturerhome made/Crabtree lab
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-9/9* and miR-124
-
Alt namemiR-9/9* and miR-124 pri-transcripts
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)655
-
GenBank IDNR_029818 NR_029814
-
Entrez GeneMir124a-2 (a.k.a. Mirn12, Mirn124a-2, mir-124, mir-124-2, mir-124a-2)
-
Entrez GeneMir9-3 (a.k.a. Mirn9-3, mir-9-3, mmu-mir-9-3)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CACTTCGTGGACCACAGACTGG
- 3′ sequencing primer GCACACCGGCCTTATTCCAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's quality control sequence is missing the following sequence upstream of IRES - "CCGCAAATT". This deletion should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTight-9-124 was a gift from Jerry Crabtree (Addgene plasmid # 31874 ; http://n2t.net/addgene:31874 ; RRID:Addgene_31874) -
For your References section:
MicroRNA-mediated conversion of human fibroblasts to neurons. Yoo AS, Sun AX, Li L, Shcheglovitov A, Portmann T, Li Y, Lee-Messer C, Dolmetsch RE, Tsien RW, Crabtree GR. Nature. 2011 Jul 13. doi: 10.1038/nature10323. 10.1038/nature10323 PubMed 21753754