Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSRP-mTAZ
(Plasmid #31795)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31795 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSRP
  • Backbone manufacturer
    Drs. S Lessnick and T. Golub (Dana-Farber Cancer Institute)
  • Vector type
    Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TAZ
  • Alt name
    WWTR1
  • gRNA/shRNA sequence
    GATGAATCCGTCCTCGGTGTTCAAGAGACACCGAGGACGGATTCATC
  • Species
    M. musculus (mouse)
  • Promoter RNA Pol-III

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSRP-mTAZ was a gift from Michael Yaffe (Addgene plasmid # 31795 ; http://n2t.net/addgene:31795 ; RRID:Addgene_31795)
  • For your References section:

    TAZ, a transcriptional modulator of mesenchymal stem cell differentiation. Hong JH, Hwang ES, McManus MT, Amsterdam A, Tian Y, Kalmukova R, Mueller E, Benjamin T, Spiegelman BM, Sharp PA, Hopkins N, Yaffe MB. Science. 2005 Aug 12;309(5737):1074-8. 10.1126/science.1110955 PubMed 16099986