pDEST47-MCU-GFP
(Plasmid #31732)

• Depositing Lab: Vamsi Mootha
• Publication: Baughman et al Nature. 2011 Jun 19. ():.

Backbone

• Vector backbone: pcDNA6.2/C-EmGFP-DEST
• Backbone manufacturer: Invitrogen (Cat#V355-20)
• Backbone size w/o insert (bp): 5784
• Modifications to backbone: None
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10/P3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MCU
• Alt name: CCDC109A
• Species: H. sapiens (human)
• Insert Size (bp): 1056
• Mutation: *
• GenBank ID: NM_138357
• Entrez Gene: MCU (a.k.a. C10orf42, CCDC109A, HsMCU)
• Promoter: CMV
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: T7
• 3′ sequencing primer: GAACTTCAGGGTCAGCTTGC

Resource Information

• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*A2T aa residue substitution in MCU, which is not known to affect protein function