-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepDEST40-pcDNA
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5485
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCU
-
Alt nameCCDC109A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1056
-
GenBank IDNM_138357
-
Entrez GeneMCU (a.k.a. C10orf42, CCDC109A, HsMCU)
- Promoter CMV
-
Tag
/ Fusion Protein
- V5-HIS6X (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer CGTAGAATCGAGACCGAGGAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST40-MCU-V5-HIS was a gift from Vamsi Mootha (Addgene plasmid # 31731 ; http://n2t.net/addgene:31731 ; RRID:Addgene_31731) -
For your References section:
Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Baughman JM, Perocchi F, Girgis HS, Plovanich M, Belcher-Timme CA, Sancak Y, Bao XR, Strittmatter L, Goldberger O, Bogorad RL, Koteliansky V, Mootha VK. Nature. 2011 Jun 19. ():. 10.1038/nature10234 PubMed 21685886