Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FuPick-shRNA
(Plasmid #31614)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31614 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUGW+H
  • Backbone size w/o insert (bp) 9000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PICK1 shRNA
  • Alt name
    Pick1
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Pick1 (a.k.a. Prkcabp)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

PICK1 shRNA: CTATGAGTACCGCCTTATCCT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FuPick-shRNA was a gift from Robert Malenka (Addgene plasmid # 31614 ; http://n2t.net/addgene:31614 ; RRID:Addgene_31614)
  • For your References section:

    Calcium binding to PICK1 is essential for the intracellular retention of AMPA receptors underlying long-term depression. Citri A, Bhattacharyya S, Ma C, Morishita W, Fang S, Rizo J, Malenka RC. J Neurosci. 2010 Dec 8. 30(49):16437-52. 10.1523/JNEUROSCI.4478-10.2010 PubMed 21147983