GFP-PICK
(Plasmid #31613)

• Depositing Lab: Robert Malenka
• Publication: Citri et al J Neurosci. 2010 Dec 8. 30(49):16437-52.

Backbone

• Vector backbone: FUGW
• Backbone manufacturer: David Baltimore (Caltech)
• Backbone size w/o insert (bp): 9941
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PICK1 (shRNA insensitive) +shRNA towards PICK1
• Alt name: PICK1
• Species: R. norvegicus (rat)
• Entrez Gene: Pick1 (a.k.a. Prkcabp)
• Tags / Fusion Proteins:
  • GFP (N terminal on insert)
  • HA (N terminal on insert)
  • PICK1 shRNA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: EGFP-C

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1.

shRNA sequence: CTATGAGTACCGCCTTATCCT