Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLIK sh human Rb 1534 hyg
(Plasmid #31500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31500 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSLIK-EGFP
  • Backbone size w/o insert (bp) 13700
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RB shRNA
  • Alt name
    RB1
  • Species
    H. sapiens (human)
  • Mutation
    The target sequence for shRB 1534 is GAACGATTATCCATTCAAA
  • Entrez Gene
    RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The whole sequence for the shRNA including the loop should be from 3872-3931 in the vector: AGCGAAACGATTATCCATTCAAATAGTGAAGCCACAGATGTATTTGAAT

The shRNA is downstream of the EGFP
GGATAATCGTT

pSLIK vector from Ian Frasier

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK sh human Rb 1534 hyg was a gift from Julien Sage (Addgene plasmid # 31500 ; http://n2t.net/addgene:31500 ; RRID:Addgene_31500)