Skip to main content
Addgene

pRLCon1288-1666
(Plasmid #31448)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31448 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRL-Con
  • Backbone size w/o insert (bp) 6380
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HNF4A 3'UTR fragment
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    379
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer taacaccgagttcgtgaaggtg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To measure regulatory potential of 3'UTR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRLCon1288-1666 was a gift from Gerhart Ryffel (Addgene plasmid # 31448 ; http://n2t.net/addgene:31448 ; RRID:Addgene_31448)
  • For your References section:

    A systematic analysis of the 3'UTR of HNF4A mRNA reveals an interplay of regulatory elements including miRNA target sites. Wirsing A, Senkel S, Klein-Hitpass L, Ryffel GU. PLoS One. 2011;6(11):e27438. Epub 2011 Nov 30. 10.1371/journal.pone.0027438 PubMed 22140441