pRLCon1-3180
(Plasmid #31445)

• Depositing Lab: Gerhart Ryffel
• Publication: Wirsing et al PLoS One. 2011;6(11):e27438. Epub 2011 Nov 30.

Backbone

• Vector backbone: pRL-Con
• Backbone size w/o insert (bp): 6380
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HNF4A 3'UTR (long)
• Species: H. sapiens (human)
• Insert Size (bp): 3180
• Entrez Gene: HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (destroyed during cloning)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: taacaccgagttcgtgaaggtg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

To measure regulatory potential of 3'UTR

Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.