-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepQE-2
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 4803
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNone
-
Insert Size (bp)4803
-
Tags
/ Fusion Proteins
- His7 (N terminal on backbone)
- TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The vector pQTEV is derived from Qiagen pQE-2 and contains an inactive chloramphenicol resistance gene sequence.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQTEV was a gift from Konrad Buessow (Addgene plasmid # 31291 ; http://n2t.net/addgene:31291 ; RRID:Addgene_31291) -
For your References section:
An automated in vitro protein folding screen applied to a human dynactin subunit. Scheich C, Niesen FH, Seckler R, Bussow K. Protein Sci. 2004 Feb . 13(2):370-80. 10.1110/ps.03304604 PubMed 14739323
Map uploaded by the depositor.
