Monomer NK
(Plasmid
#31178)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 31178 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepJ201
- Backbone size w/o insert (bp) 2672
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMonomer-NK
-
Alt nameTALE Monomer NK
-
SpeciesXanthomonas
-
Insert Size (bp)102
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GATGGTAGTGTGGGGACTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA 2.0
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Monomer NK was a gift from Feng Zhang (Addgene plasmid # 31178 ; http://n2t.net/addgene:31178 ; RRID:Addgene_31178)