Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pS3aG
(Plasmid #31171)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31171 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    N/A
  • Backbone size (bp) 10930
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH5alpha, standard LB
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CACATGTGCAAGAGAACCCAGTG
  • 3′ sequencing primer CTGCGCTTGTTTATTTGCTTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

284 bp attB recombination sequence

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pS3aG was a gift from Thomas Williams (Addgene plasmid # 31171 ; http://n2t.net/addgene:31171 ; RRID:Addgene_31171)
  • For your References section:

    The regulation and evolution of a genetic switch controlling sexually dimorphic traits in Drosophila. Williams TM, Selegue JE, Werner T, Gompel N, Kopp A, Carroll SB. Cell. 2008 Aug 22;134(4):610-23. doi: 10.1016/j.cell.2008.06.052. 10.1016/j.cell.2008.06.052 PubMed 18724934