Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pD2eGFP-5xUTR
(Plasmid #31121)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31121 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    5xoligonucleotides eGFPutr
  • Insert Size (bp)
    150

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GFPutrNotF oligo sequence - CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT.

This is similar to the reporter described in the manuscript, “pD2eGFP-6XUTR.” This is designed to be especially sensitive to regulation by the InvivoGen commercial GFP shRNA and therefore has 3 extra perfect complementary shRNA binding sites and one imperfect in the 3’ UTR for a total of 5 possible shRNA docking sites (1 in coding region, 4 in 3’ UTR). The pD2eGFP-5XUTR construct is similar to the pD2eGFP-6XUTR construct in its increased susceptibility to regulation by the InvivoGen shRNA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pD2eGFP-5xUTR was a gift from Christopher Sullivan (Addgene plasmid # 31121 ; http://n2t.net/addgene:31121 ; RRID:Addgene_31121)
  • For your References section:

    A virus-encoded inhibitor that blocks RNA interference in mammalian cells. Sullivan CS, Ganem D. J Virol. 2005 Jun . 79(12):7371-9. 10.1128/JVI.79.12.7371-7379.2005 PubMed 15919892