pD2eGFP-5xUTR
(Plasmid #31121)

• Depositing Lab: Christopher Sullivan
• Publication: Sullivan et al J Virol. 2005 Jun . 79(12):7371-9.

Backbone

• Vector backbone: pcDNA3.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5400
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 5xoligonucleotides eGFPutr
• Insert Size (bp): 150

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: CMV-F
• 3′ sequencing primer: BGH-rev

Resource Information

• Supplemental Documents:
  • Plasmid map

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GFPutrNotF oligo sequence - CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT.

This is similar to the reporter described in the manuscript, “pD2eGFP-6XUTR.” This is designed to be especially sensitive to regulation by the InvivoGen commercial GFP shRNA and therefore has 3 extra perfect complementary shRNA binding sites and one imperfect in the 3’ UTR for a total of 5 possible shRNA docking sites (1 in coding region, 4 in 3’ UTR). The pD2eGFP-5XUTR construct is similar to the pD2eGFP-6XUTR construct in its increased susceptibility to regulation by the InvivoGen shRNA.