-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31073 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA6.2-GW/EmGFP
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5699
-
Vector typeMammalian Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSUMO2/3 microRNA
-
Alt nameSUMO2/3
-
gRNA/shRNA sequenceSUMO2: GATCTGCCTCATTGACAAAC; SUMO3: AATCGAATCTGCCTCATTGAC
-
SpeciesH. sapiens (human)
-
Entrez GeneSUMO2 (a.k.a. HSMT3, SMT3B, SMT3H2, SUMO3, Smt3A)
-
Entrez GeneSUMO3 (a.k.a. SMT3A, SMT3H1, SUMO-3, Smt3B)
-
Tag
/ Fusion Protein
- EmGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site attB1 (unknown if destroyed)
- 3′ cloning site attB2 (unknown if destroyed)
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA6.2-GW/EmGFP-miR-SUMO23 was a gift from Wulf Paschen (Addgene plasmid # 31073 ; http://n2t.net/addgene:31073 ; RRID:Addgene_31073) -
For your References section:
Gene expression and cell growth are modified by silencing SUMO2 and SUMO3 expression. Yang W, Paschen W. Biochem Biophys Res Commun. 2009 Apr 24. 382(1):215-8. 10.1016/j.bbrc.2009.03.013 PubMed 19275883