pNK5
(Plasmid #31040)

• Depositing Labs: Adam Bogdanove, Daniel Voytas
• Publication: Cermak et al Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218

Backbone

• Vector backbone: pTC14
• Backbone size w/o insert (bp): 2989

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Top10/LB+antibiotics
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: repeat NK5
• Species: Xanthamonas oryzae
• Insert Size (bp): 111

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: pTC14_F2 (caagcctgattgggagaaaa)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Cellectis Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMPORTANT NOTE!: Restriction digests show that the pNK series of plasmids is actually about 2.5kb, not 3.1kb as the sequence-based map below suggests. All important features are present in the plasmid and the construct should function as reported despite this size discrepancy.