Skip to main content
Addgene

pTAL2
(Plasmid #31033)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 31033 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR8-GW modified
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2676

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    DH10B/LB+antibiotics
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TALE fusion
  • Species
    Xanthamonas oryzae
  • Insert Size (bp)
    2098

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer TAL_F1 (ttggcgtcggcaaacagtgg)
  • 3′ sequencing primer TAL_R2 (ggcgacgaggtggtcgttgg)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gateway compatible vector for assembly of fusion ready, full length TAL effector genes by Golden Gate cloning. Lacks a stop codon and contains both SD and Kozak sequences immediately upstream the initial ATG. Designed for TAL DNA-binding domains to be fused with another protein domain of the user's choice

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTAL2 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31033 ; http://n2t.net/addgene:31033 ; RRID:Addgene_31033)
  • For your References section:

    Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687