pNN2
(Plasmid
#31008)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTC14
- Backbone size w/o insert (bp) 2989
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH10B/LB+antibiotics
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerepeat NN2
-
SpeciesXanthamonas oryzae
-
Insert Size (bp)116
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pTC14_F2 (caagcctgattgggagaaaa) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNN2 was a gift from Adam Bogdanove & Daniel Voytas (Addgene plasmid # 31008 ; http://n2t.net/addgene:31008 ; RRID:Addgene_31008) -
For your References section:
Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. 2011 Jul;39(12):e82. doi: 10.1093/nar/gkr218 10.1093/nar/gkr218 PubMed 21493687