pSUPER retro puro macroH2A1 shRNA
(Plasmid
#30517)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSUPER retro puro
-
Backbone manufacturerOligoEngine
- Backbone size w/o insert (bp) 6343
-
Modifications to backboneLinearized BlgII/HindIII
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemH2A1 shRNA
-
Alt namemacroH2A1 shRNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)61
-
GenBank IDmacroH2A1 all 4 isoforms
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTCGAACGAGGAGGTTCAAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
H2A1 shRNA: 5’-GGGTGCAGACAAATGTGAA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUPER retro puro macroH2A1 shRNA was a gift from John Gurdon (Addgene plasmid # 30517 ; http://n2t.net/addgene:30517 ; RRID:Addgene_30517) -
For your References section:
Histone variant macroH2A confers resistance to nuclear reprogramming. Pasque V, Gillich A, Garrett N, Gurdon JB. EMBO J. 2011 May 6. ():. 10.1038/emboj.2011.144 PubMed 21552206