pp2.1-PT5-lacI-gusA-specR-pp2.2-IMBB
(Plasmid #30505)

• Depositing Lab: Ichiro Matsumura
• Publication: Murin et al Appl Environ Microbiol. 2011 Oct 21.

Backbone

• Vector backbone: pBAV1k
• Backbone size w/o insert (bp): 2792
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Any strain that has LacI repressor.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: beta-glucuronidase
• Alt name: gusA
• Alt name: pIM1463
• Species: Escherichia coli
• Insert Size (bp): 1796
• Entrez Gene: gusA (a.k.a. ECO111_2086)
• Tag / Fusion Protein:
  • His (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, XbaI (not destroyed)
• 3′ cloning site: SpeI, PstI (not destroyed)
• 5′ sequencing primer: gacgaactccaattcactgttccttgc
• 3′ sequencing primer: ggagagcgttcaccgacaaacaacag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This lab.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In our experience, plasmid yields are highest when cells are harvest at late log stage.

Note that this plasmid also confers resistance to Spectinomycin, but Addgene provides it in an Amp stab.