lacI-Ptac-gusA-pBAV1k
(Plasmid #30503)

• Depositing Lab: Ichiro Matsumura
• Publication: Murin et al Appl Environ Microbiol. 2011 Oct 21.

Backbone

• Vector backbone: pBAV1k
• Backbone size w/o insert (bp): 2792
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: beta-glucuronidase
• Alt name: gusA
• Alt name: pIM1445
• Species: Escherichia coli
• Insert Size (bp): 1796
• GenBank ID: JF828584
• Entrez Gene: gusA (a.k.a. ECO111_2086)
• Tag / Fusion Protein:
  • His (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI, XbaI, NheI, SphI (not destroyed)
• 3′ cloning site: HindIII, SpeI, PstI, ClaI (not destroyed)
• 5′ sequencing primer: gacgaactccaattcactgttccttgc
• 3′ sequencing primer: ggagagcgttcaccgacaaacaacag

Resource Information

• A portion of this plasmid was derived from a plasmid made by: This lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In our experience, plasmid yields are highest when cells are harvest at late log stage.