Skip to main content
Addgene

Beclin-BATS
(Plasmid #30498)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    phrGFP-N1
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beclin, Barkor
  • Alt name
    ATG6; ATG14L/ATG14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1592
  • Mutation
    Beclin 1 + 413-492 aa of Barkor
  • GenBank ID
    AF139131 KIAA0831
  • Entrez Gene
    BECN1 (a.k.a. ATG6, VPS30, beclin1)
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Tags / Fusion Proteins
    • hrGFP (N terminal on backbone)
    • 3xFlag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Beclin-BATS was a gift from Qing Zhong (Addgene plasmid # 30498 ; http://n2t.net/addgene:30498 ; RRID:Addgene_30498)
  • For your References section:

    Autophagosome targeting and membrane curvature sensing by Barkor/Atg14(L). Fan W, Nassiri A, Zhong Q. Proc Natl Acad Sci U S A. 2011 Apr 25. ():. 10.1073/pnas.1016472108 PubMed 21518905