hrGFP-BATS
(Plasmid #30496)

• Depositing Lab: Qing Zhong
• Publication: Fan et al Proc Natl Acad Sci U S A. 2011 Apr 25. ():.

Backbone

• Vector backbone: phrGFP-N1
• Backbone manufacturer: Agilent Technologies
• Backbone size w/o insert (bp): 4300
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Barkor
• Alt name: ATG14L/ATG14
• Species: H. sapiens (human)
• Insert Size (bp): 240
• Mutation: 413-492 aa
• GenBank ID: KIAA0831
• Entrez Gene: ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
• Tags / Fusion Proteins:
  • hrGFP (N terminal on backbone)
  • 3xFlag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CAGCTGACCAGCCTGGGCAAG
• 3′ sequencing primer: TAATACGACTCACTATAGGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry