pHR-SIN-PTEN-D24Y
(Plasmid
#30374)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-SIN
- Backbone size w/o insert (bp) 9000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN-D24Y
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1209
-
MutationD24Y
-
GenBank IDU93051
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer CCAAGGACCTGAAATGACCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SIN-PTEN-D24Y was a gift from Todd Waldman (Addgene plasmid # 30374 ; http://n2t.net/addgene:30374 ; RRID:Addgene_30374) -
For your References section:
Mechanistic Analysis of a DNA Damage-Induced, PTEN-Dependent Size Checkpoint in Human Cells. Kim JS, Xu X, Li H, Solomon D, Lane WS, Jin T, Waldman T. Mol Cell Biol. 2011 Jul . 31(13):2756-71. 10.1128/MCB.01323-10 PubMed 21536651