-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30323 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.1 puro
-
Backbone manufacturerAvailable at Addgene (#8453)
- Backbone size w/o insert (bp) 7000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP shRNA
-
Alt nameshGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
shRNA directed against GFP (Target sequence: 5'GCAAGCTGACCCTGAAGTTCAT3'). Used as control shRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 GFP shRNA was a gift from David Sabatini (Addgene plasmid # 30323 ; http://n2t.net/addgene:30323 ; RRID:Addgene_30323) -
For your References section:
The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Sancak Y, Peterson TR, Shaul YD, Lindquist RA, Thoreen CC, Bar-Peled L, Sabatini DM. Science. 2008 Jun 13. 320(5882):1496-501. 10.1126/science.1157535 PubMed 18497260