Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCB6 ZO1myc
(Plasmid #30317)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30317 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCB6
  • Backbone size w/o insert (bp) 6189
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Zonula Occludens-1
  • Alt name
    TJP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5364
  • Mutation
    none
  • Entrez Gene
    TJP1 (a.k.a. ZO-1)
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn I (not destroyed)
  • 3′ cloning site Xba I (destroyed during cloning)
  • 5′ sequencing primer GTTGACGCAAATGGGCGGTAGGC
  • 3′ sequencing primer GTCAGACAAAATGATGCAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pCB6 expression vector originally from Ann Hubbard, Johns Hopkins University. Contains:
CMV promoter, hGH terminator
SV40 polyA signal
pBR322 ori

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB6 ZO1myc was a gift from James Anderson & Alan Fanning (Addgene plasmid # 30317 ; http://n2t.net/addgene:30317 ; RRID:Addgene_30317)
  • For your References section:

    The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. Fanning AS, Jameson BJ, Jesaitis LA, Anderson JM. J Biol Chem. 1998 Nov 6. 273(45):29745-53. 10.1074/jbc.273.45.29745 PubMed 9792688