Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP ZO1
(Plasmid #30313)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 30313 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4735
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zonula Occludens-1
  • Alt name
    ZO-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5675
  • Mutation
    Unique spliceform*
  • Entrez Gene
    TJP1 (a.k.a. ZO-1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac I (not destroyed)
  • 3′ cloning site Pst I (destroyed during cloning)
  • 5′ sequencing primer pEGFP-N
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

From the author: The insert is an alternatively spliced domain (which we have confirmed in several ways) that is common to the prevalent ZO-1 species in most epithelial cells. It is adjacent to the conserved ZU5 domain.

This isoform is not present in all of the cDNAs we have worked with, but we chose to use this isoform for our GFP ZO-1 studies. This is the cDNA and spliceform that I used in all of our studies.

The alt splice is actually 60 bp, and is as follows:

GCGTCCATGACTCCTGACGGTTGGTCTTTTGCTCTAAAATCATCCGACTCCTCGTCGGGT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP ZO1 was a gift from Alan Fanning (Addgene plasmid # 30313 ; http://n2t.net/addgene:30313 ; RRID:Addgene_30313)
  • For your References section:

    Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. Fanning AS, Ma TY, Anderson JM. FASEB J. 2002 Nov . 16(13):1835-7. 10.1096/fj.02-0121fje PubMed 12354695