pEGFP ZO1
(Plasmid #30313)

• Depositing Lab: Alan Fanning
• Publication: Fanning et al FASEB J. 2002 Nov . 16(13):1835-7.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4735
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Zonula Occludens-1
• Alt name: ZO-1
• Species: H. sapiens (human)
• Insert Size (bp): 5675
• Mutation: Unique spliceform*
• Entrez Gene: TJP1 (a.k.a. ZO-1)
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac I (not destroyed)
• 3′ cloning site: Pst I (destroyed during cloning)
• 5′ sequencing primer: pEGFP-N

Resource Information

• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

From the author: The insert is an alternatively spliced domain (which we have confirmed in several ways) that is common to the prevalent ZO-1 species in most epithelial cells. It is adjacent to the conserved ZU5 domain.

This isoform is not present in all of the cDNAs we have worked with, but we chose to use this isoform for our GFP ZO-1 studies. This is the cDNA and spliceform that I used in all of our studies.

The alt splice is actually 60 bp, and is as follows:

GCGTCCATGACTCCTGACGGTTGGTCTTTTGCTCTAAAATCATCCGACTCCTCGTCGGGT