pET MBP-FlAsH LIC cloning vector (MBP-FlAsH)
(Plasmid #30185)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: C-terminal fluorescent fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 6568
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tags / Fusion Proteins:
  • FlAsH (C terminal on backbone)
  • Biotin-H6-MBP-TEV recognition (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: LIC site vGFP (destroyed during cloning)
• 3′ cloning site: LIC site vGFP (destroyed during cloning)
• 5′ sequencing primer: MBP forward (5'ggtcgtcagactgtcgatgaagcc)
• 3′ sequencing primer: T7 reverse

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.

This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.

Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TACTTCCAATCCAATGCA3'

Reverse - 5' CTCCCACTACCAATGCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with SspI, then gel purify.

When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/