pGFPHYG2
(Plasmid #30173)

• Depositing Lab: Lalita Ramakrishnan
• Publication: Cosma et al Infect Immun. 2006 Jun . 74(6):3125-33.

Backbone

• Vector backbone: pFPV27
• Backbone manufacturer: Ramakrishnan et al., 2000
• Backbone size w/o insert (bp): 4981
• Vector type: Mycobacteria expression

Growth in Bacteria

• Bacterial Resistance(s): Hygromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Mycobacterium Strong Promoter (MSP)
• Species: M. marinum
• Insert Size (bp): 500
• Mutation: GFPmut3 allele has improved brightness.
• Tag / Fusion Protein:
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
• 3′ sequencing primer: GFP-R

Resource Information

• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was derived from pMSP12::GFP by interrupting the aph gene (removing a small ~300bp NsiI fragment) and inserting the gene for Hygromycin resistance.