-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30171 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFPV27
-
Backbone manufacturerRamakrishnan et al., 2000
- Backbone size w/o insert (bp) 4981
-
Vector typeMycobacteria expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMycobacterium Strong Promoter (MSP)
-
SpeciesM. marinum
-
Insert Size (bp)500
-
Tag
/ Fusion Protein
- dsRed2 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer pFPV27-Fwd: GAATCGGTGGTTGTGGTGAT
- 3′ sequencing primer dsRed1-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was derived from pMSP12::GFP (Addgene plasmid # 30167) by replacing the GFP with dsRed2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSP12::dsRed2 was a gift from Lalita Ramakrishnan (Addgene plasmid # 30171 ; http://n2t.net/addgene:30171 ; RRID:Addgene_30171) -
For your References section:
Superinfecting mycobacteria home to established tuberculous granulomas. Cosma CL, Humbert O, Ramakrishnan L. Nat Immunol. 2004 Aug . 5(8):828-35. 10.1038/ni1091 PubMed 15220915