pENTR APP shRNA 1
(Plasmid
#30134)
-
Depositing Labs
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 30134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepENTR
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPP shRNA 1
-
Alt nameAPP shRNA moderately active
-
gRNA/shRNA sequencegcacatgaatgtgcagaatgg
-
Insert Size (bp)50
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gcacatgaatgtgcagaatgg
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR APP shRNA 1 was a gift from Dennis Selkoe & Tracy Young-Pearse (Addgene plasmid # 30134 ; http://n2t.net/addgene:30134 ; RRID:Addgene_30134) -
For your References section:
A critical function for beta-amyloid precursor protein in neuronal migration revealed by in utero RNA interference. Young-Pearse TL, Bai J, Chang R, Zheng JB, LoTurco JJ, Selkoe DJ. J Neurosci. 2007 Dec 26. 27(52):14459-69. 10.1523/JNEUROSCI.4701-07.2007 PubMed 18160654