-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP N1
- Backbone size w/o insert (bp) 3984
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDYSF-Venus
-
Alt nameDysferlin-3HA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6328
-
GenBank IDNM_003494
-
Entrez GeneDYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)
-
Tag
/ Fusion Protein
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe 1 (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer CCAAAATCAACGGGACTTTCC
- 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DYSF-Venus was a gift from Steven Vogel (Addgene plasmid # 29768 ; http://n2t.net/addgene:29768 ; RRID:Addgene_29768) -
For your References section:
Membrane wounding triggers ATP release and dysferlin-mediated intercellular calcium signaling. Covian-Nares JF, Koushik SV, Puhl HL, Vogel SS. J Cell Sci. 2010 Jun 1. 123(Pt 11):1884-93. 10.1242/jcs.066084 PubMed 20442251
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/17/86/f1273562-af63-11e0-90fe-003048dd6500.jpeg.940x940_q85_autocrop.png)