DYSF-3HA
(Plasmid #29767)

• Depositing Lab: Steven Vogel
• Publication: Covian-Nares et al J Cell Sci. 2010 Jun 1. 123(Pt 11):1884-93.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5428
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: DYSF
• Alt name: Dysferlin
• Species: H. sapiens (human)
• Insert Size (bp): 6328
• GenBank ID: NM_003494
• Entrez Gene: DYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)
• Tag / Fusion Protein:
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco R1 (not destroyed)
• 3′ cloning site: Eco RV (not destroyed)
• 5′ sequencing primer: ATGCTGAGGGTCTTCATCCTCTAT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry