-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29767 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDYSF
-
Alt nameDysferlin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6328
-
GenBank IDNM_003494
-
Entrez GeneDYSF (a.k.a. FER1L1, LGMD2B, LGMDR2, MMD1)
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Eco R1 (not destroyed)
- 3′ cloning site Eco RV (not destroyed)
- 5′ sequencing primer ATGCTGAGGGTCTTCATCCTCTAT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DYSF-3HA was a gift from Steven Vogel (Addgene plasmid # 29767 ; http://n2t.net/addgene:29767 ; RRID:Addgene_29767) -
For your References section:
Membrane wounding triggers ATP release and dysferlin-mediated intercellular calcium signaling. Covian-Nares JF, Koushik SV, Puhl HL, Vogel SS. J Cell Sci. 2010 Jun 1. 123(Pt 11):1884-93. 10.1242/jcs.066084 PubMed 20442251