MSCV puro let-7 sponge
(Plasmid #29766)

• Depositing Lab: Phil Sharp
• Publication: Kumar et al Proc Natl Acad Sci U S A. 2008 Feb 28. ():.

Backbone

• Vector backbone: MSCV puro
• Backbone size w/o insert (bp): 6000
• Vector type: Mammalian Expression, Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: let-7 sponge
• Insert Size (bp): 150

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: blunt (unknown if destroyed)
• 5′ sequencing primer: pLXSN-5

Resource Information

• Supplemental Documents:
  • Cloning information from depositor
• Articles Citing this Plasmid:
  • 8 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs