pET MBP mCherry LIC cloning vector (MBP-mCherry)
(Plasmid #29747)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: C-terminal fluorescent fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 7270
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tags / Fusion Proteins:
  • Biotin - His6 - MBP -TEV (N terminal on backbone)
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: LIC site vGFP (destroyed during cloning)
• 3′ cloning site: LIC site vGFP (destroyed during cloning)
• 5′ sequencing primer: MBP forward (5'ggtcgtcagactgtcgatgaagcc)
• 3′ sequencing primer: mCherry reverse (5'gcaccttgaagcgcatgaact)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.

mCherry has a excitation max of 587 nm and an emission max of 610 nm. A TEV-cleavable MBP will be added to the N-terminal side of your protein to enhance solubility.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'CTCCCACTACCAATGCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with SspI, then gel purify.

When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/