Skip to main content
Addgene

pET His6 prescission LIC cloning vector (HPKS)
(Plasmid #29720)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29720 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 6969
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • His6-prescission (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SLIC site w/ stuffer (destroyed during cloning)
  • 3′ cloning site SLIC site w/ stuffer (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.

Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.

To clone into this vector, add SLIC tags to the 5' end of your PCR primers.

Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'

Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'

Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.

When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 prescission LIC cloning vector (HPKS) was a gift from Scott Gradia (Addgene plasmid # 29720 ; http://n2t.net/addgene:29720 ; RRID:Addgene_29720)