pET His6 prescission LIC cloning vector (HPKS)
(Plasmid #29720)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: Prescission-cleavable N-terminal fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 6969
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tag / Fusion Protein:
  • His6-prescission (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SLIC site w/ stuffer (destroyed during cloning)
• 3′ cloning site: SLIC site w/ stuffer (destroyed during cloning)
• 5′ sequencing primer: T7 forward
• 3′ sequencing primer: T7 reverse

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a SLIC cloning protocol.

Prescission is a highly specific protease that cleaves LEVLFQ/GP. It is generally more active than TEV protease, and many users have found that when their protein inhibits TEV cleavage, switching to a prescission vector has proved worthwhile.

To clone into this vector, add SLIC tags to the 5' end of your PCR primers.

Forward - 5'GTGCTGTTCCAGGGTCCGAAT3'

Reverse - 5'TGGTGGTGGTGGTGCTCGA(TTA)3'

Linearize the plasmid with SspI and XhoI, then gel purify. There is a 1650 bp stuffer sequence that will be visible on a gel.

When digesting the DNA with T4 polymerase, use no nucleotides for either your insert or the linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/