pET His6 Sumo TEV LIC cloning vector (2S-T)
(Plasmid #29711)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: 2-series LIC N-terminal fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 5104
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tag / Fusion Protein:
  • His6-Sumo-TEV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: LIC site (destroyed during cloning)
• 3′ cloning site: LIC site (destroyed during cloning)
• 5′ sequencing primer: Sumo forward (5'ttattgaggctcacagagaac)
• 3′ sequencing primer: T7 reverse

Resource Information

• Articles Citing this Plasmid:
  • 22 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2S-T has a TEV-cleavable N-terminal His6-Sumo fusion tag. Sumo can improve the expression and solubility of your target protein.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/macrolab/

Information for Cloning Grade DNA (Catalog # 29711-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here