pET LIC cloning vector (2A-T)
(Plasmid #29665)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: 2-series LIC N-terminal fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 4731
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ cloning site: LIC site v2 (destroyed during cloning)
• 3′ cloning site: LIC site v2 (destroyed during cloning)
• 5′ sequencing primer: T7 forward
• 3′ sequencing primer: T7 reverse

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2A-T has no fusion tags, for those who want to express native protein.

To clone into this vector, add LIC v2 tags to the 5' end of your PCR primers.

Forward - 5'TTTAAGAAGGAGATATAGATC3'

Reverse - 5'TTATGGAGTTGGGATCTTATTA3'

Linearize the plasmid with EcoRV and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/