-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 29654 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET
- Backbone size (bp) 6507
-
Vector typeBacterial Expression
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- MBP (N terminal on backbone)
- 10xAsn (N terminal on backbone)
- TEV cleavage site (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNone
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site LIC tag (destroyed during cloning)
- 3′ cloning site LIC tag (destroyed during cloning)
- 5′ sequencing primer MBP forward (5'ggtcgtcagactgtcgatgaagcc)
- 3′ sequencing primer T7 reverse (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. MBP can enhance the expression and solubility of your protein of interest. The long poly-Asn linker may help avoid steric clashes between your protein and MBP. If a shorter linker is desired, please use vector 1M.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET His6 MBP Asn10 TEV LIC cloning vector (1C) was a gift from Scott Gradia (Addgene plasmid # 29654 ; http://n2t.net/addgene:29654 ; RRID:Addgene_29654)