pET His6 TEV LIC cloning vector (1B)
(Plasmid #29653)

• Purpose: (Empty Backbone)
• Depositing Lab: Scott Gradia
• Publication: LIC N-terminal fusion vectors for E. coli expression (unpublished)

Backbone

• Vector backbone: pET
• Backbone size (bp): 5343
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: None
• Tag / Fusion Protein:
  • His6-TEV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: LIC tag (destroyed during cloning)
• 3′ cloning site: LIC tag (destroyed during cloning)
• 5′ sequencing primer: T7 promoter
• 3′ sequencing primer: T7 reverse

Resource Information

• Articles Citing this Plasmid:
  • 46 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable His6 fusion tag on its N-terminus.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/