Skip to main content
Addgene

psiCHECK2-E2F3 3'UTR
(Plasmid #29470)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29470 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    psiCHECK2 (Promega)
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E2F3 3'UTR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3325
  • Entrez Gene
    E2F3 (a.k.a. E2F-3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GTCCGCAACTACAACGCCTACCTT
  • 3′ sequencing primer AATGAGAGTGTTTCGTTCCTTCC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-E2F3 3'UTR was a gift from Judy Lieberman (Addgene plasmid # 29470 ; http://n2t.net/addgene:29470 ; RRID:Addgene_29470)

  • For your References section:

    miR-24 Inhibits cell proliferation by targeting E2F2, MYC, and other cell-cycle genes via binding to "seedless" 3'UTR microRNA recognition elements. Lal A, Navarro F, Maher CA, Maliszewski LE, Yan N, O'Day E, Chowdhury D, Dykxhoorn DM, Tsai P, Hofmann O, Becker KG, Gorospe M, Hide W, Lieberman J. Mol Cell. 2009 Sep 11. 35(5):610-25. 10.1016/j.molcel.2009.08.020 PubMed 19748357
Related items:
Commonly requested with: