Skip to main content
Addgene

Venus Cam KII alpha 1-315aa
(Plasmid #29431)

Print

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29431 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP C1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus CAM KII Alpha
  • Alt name
    V-Cam
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1440
  • Mutation
    Expresses CamKIIa amino acids 1-315
  • GenBank ID
    NM_171825
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus Cam KII alpha 1-315aa was a gift from Steven Vogel (Addgene plasmid # 29431 ; http://n2t.net/addgene:29431 ; RRID:Addgene_29431)

  • For your References section:

    Structural rearrangement of CaMKIIalpha catalytic domains encodes activation. Thaler C, Koushik SV, Puhl HL, Blank PS, Vogel SS. Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74. 10.1073/pnas.0901913106 PubMed 19339497
Related items: