Addgene: Venus Cam KII alpha mutant T286A Skip to main content
Addgene

Venus Cam KII alpha mutant T286A
(Plasmid #29430)

Full plasmid sequence is not available for this item.

Created with RaphaëlVenus Cam KII alpha mutant T286ABam HIVenus CAM KII A…VenusSal 1

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 29430 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP C1
  • Backbone size w/o insert (bp) 3984
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Venus CAM KII Alpha
  • Alt name
    V-Cam
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1437
  • Mutation
    T286A mutation in CamKIIa sequence
  • GenBank ID
    NM_171825
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal 1 (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer CCAAAATCAACGGGACTTTCC
  • 3′ sequencing primer CAGGTTCAGGGGGAGGTGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus Cam KII alpha mutant T286A was a gift from Steven Vogel (Addgene plasmid # 29430 ; http://n2t.net/addgene:29430 ; RRID:Addgene_29430)
  • For your References section:

    Structural rearrangement of CaMKIIalpha catalytic domains encodes activation. Thaler C, Koushik SV, Puhl HL, Blank PS, Vogel SS. Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74. 10.1073/pnas.0901913106 PubMed 19339497