Venus Cam KII alpha mutant T286A
(Plasmid #29430)

• Depositing Lab: Steven Vogel
• Publication: Thaler et al Proc Natl Acad Sci U S A. 2009 Apr 14. 106(15):6369-74.

Backbone

• Vector backbone: pEGFP C1
• Backbone size w/o insert (bp): 3984
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus CAM KII Alpha
• Alt name: V-Cam
• Species: M. musculus (mouse)
• Insert Size (bp): 1437
• Mutation: T286A mutation in CamKIIa sequence
• GenBank ID: NM_171825
• Tag / Fusion Protein:
  • Venus (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal 1 (not destroyed)
• 3′ cloning site: Bam HI (not destroyed)
• 5′ sequencing primer: CCAAAATCAACGGGACTTTCC
• 3′ sequencing primer: CAGGTTCAGGGGGAGGTGTGG

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry